View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0113-INSERTION-4 (Length: 113)
Name: NF0113-INSERTION-4
Description: NF0113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0113-INSERTION-4 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 7 - 113
Target Start/End: Complemental strand, 41638614 - 41638508
Alignment:
Q |
7 |
aaataaatgaaaaaggttagaattttgacatatagtaacggaccgtaaatatggttccttccatatttctatttaatctgttgtggagatacgtttgact |
106 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
41638614 |
aaataaatgaaaaaggttagaattttgacatatagtaacggaccgtaaatatggttccttccatatttctatttaatttgttgtggagatacgtttgact |
41638515 |
T |
 |
Q |
107 |
gaagctt |
113 |
Q |
|
|
||||||| |
|
|
T |
41638514 |
gaagctt |
41638508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University