View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0113-INSERTION-4 (Length: 113)

Name: NF0113-INSERTION-4
Description: NF0113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0113-INSERTION-4
NF0113-INSERTION-4
[»] chr8 (1 HSPs)
chr8 (7-113)||(41638508-41638614)


Alignment Details
Target: chr8 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 7 - 113
Target Start/End: Complemental strand, 41638614 - 41638508
Alignment:
7 aaataaatgaaaaaggttagaattttgacatatagtaacggaccgtaaatatggttccttccatatttctatttaatctgttgtggagatacgtttgact 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
41638614 aaataaatgaaaaaggttagaattttgacatatagtaacggaccgtaaatatggttccttccatatttctatttaatttgttgtggagatacgtttgact 41638515  T
107 gaagctt 113  Q
    |||||||    
41638514 gaagctt 41638508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University