View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0113-INSERTION-5 (Length: 275)
Name: NF0113-INSERTION-5
Description: NF0113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0113-INSERTION-5 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 8 - 275
Target Start/End: Complemental strand, 18464477 - 18464210
Alignment:
Q |
8 |
catggtgggctggagaactccatattggaatcacgcttgtaccctcttgtggagtagaccaatgccagaaggtttggtcctcaggactctctgcccgtcg |
107 |
Q |
|
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18464477 |
catggtgggctcgagaactccatattggattcacgcttgtaccctcttgtggagtagaccaatgccagaaggtttggtcctcaggactctctgcccgtcg |
18464378 |
T |
 |
Q |
108 |
aaggatacctgcaagggggatggaagactgcctggctttgattggcccgctcctgggtatgactatgagtactcccaaacagaagtctgcatcctttgcc |
207 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18464377 |
aaggatacctgcaagggggatggaagacttcctggctttcattggcccgctcctgggtatgactatgagtactcccaaacagaagtctgcatcctttgcc |
18464278 |
T |
 |
Q |
208 |
ggttcgacactgaacttcatggatttctaacgacctttaagttaatttagggctatttatcttttgta |
275 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
18464277 |
ggttcgacactgaacttcgtggatttctaacgacctttaagttaatttagggctatttatattttgta |
18464210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University