View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0113_high_11 (Length: 262)
Name: NF0113_high_11
Description: NF0113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0113_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 14525422 - 14525162
Alignment:
Q |
1 |
atggtatcaacaaaacgagttatttttaaaatatatttacccctgccctcnnnnnnngtatatatttacctctattttgaatcattatgtacacgaccgc |
100 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14525422 |
atggtatcaacaaaacgagttattcttaaaatatatttacccctgccctaaaaaaaagtatatatttacctctattttgaatcattatgtacacgaccgc |
14525323 |
T |
 |
Q |
101 |
ccccaaaacacccaaattcaataatttaatacnnnnnnnn----caatgaataat---ttggtactcttatgatgatgtgcttggcactattataccagt |
193 |
Q |
|
|
||||||||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14525322 |
ccccaaaacacccaaattcaataatttgatacttttttttttttcaatgaataataatttggtactcttatgatgatgtgcttggcactattataccagt |
14525223 |
T |
 |
Q |
194 |
gcattttctttttgacacaggcagtataccagcaacatagtggctcacatgtctctctgct |
254 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14525222 |
gcattttctttttgacacaggcagtataccagcaacatagtggctcacatgtctctctgct |
14525162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1782 times since January 2019
Visitors: 1427