View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0113_high_8 (Length: 290)

Name: NF0113_high_8
Description: NF0113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0113_high_8
NF0113_high_8
[»] chr7 (1 HSPs)
chr7 (1-208)||(49087368-49087575)


Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 49087575 - 49087368
Alignment:
1 tgaagccatagatggcagcaccgacaaccgtgaagtggggtttgtgtggacggtagacaagccagagaacaagtagagtgacaccgattagtaggagaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49087575 tgaagccatagatggcagcaccgacaaccgtgaagtggggtttgtgtggacggtagacaagccagagaacaagtagagtgacaccgattagtaggagaaa 49087476  T
101 gatggtgaggaatgtggcaaaagcacgtccggaagaacttgtgccgtaggaagaagaaggtggtggaccagcaggtttgttcatttgtagtttgtcaggg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49087475 gatggtgaggaatgtggcaaaagcacgtccggaagaacttgtgccgtaggaagaagaaggtggtggaccagcaggtttgttcatttgtagtttgtcaggg 49087376  T
201 gggagatg 208  Q
    ||||||||    
49087375 gggagatg 49087368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University