View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0113_low_21 (Length: 302)
Name: NF0113_low_21
Description: NF0113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0113_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 99 - 216
Target Start/End: Complemental strand, 15380667 - 15380549
Alignment:
| Q |
99 |
caaaacacattttgagttcagaattcccacttctttcattcacacttaccagttacatgaccaatccattaattgcatctttgtggag-tatattatttc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15380667 |
caaaacacattttgagttcagaattcccacttctttcatccacacttaccagttacatgaccaatccattaattgcatctttgtggagttatattatttc |
15380568 |
T |
|
| Q |
198 |
cctttctcactctctacat |
216 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
15380567 |
cctttctcactctctacat |
15380549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1699 times since January 2019
Visitors: 1426