View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0113_low_23 (Length: 290)
Name: NF0113_low_23
Description: NF0113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0113_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 49087575 - 49087368
Alignment:
Q |
1 |
tgaagccatagatggcagcaccgacaaccgtgaagtggggtttgtgtggacggtagacaagccagagaacaagtagagtgacaccgattagtaggagaaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49087575 |
tgaagccatagatggcagcaccgacaaccgtgaagtggggtttgtgtggacggtagacaagccagagaacaagtagagtgacaccgattagtaggagaaa |
49087476 |
T |
 |
Q |
101 |
gatggtgaggaatgtggcaaaagcacgtccggaagaacttgtgccgtaggaagaagaaggtggtggaccagcaggtttgttcatttgtagtttgtcaggg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49087475 |
gatggtgaggaatgtggcaaaagcacgtccggaagaacttgtgccgtaggaagaagaaggtggtggaccagcaggtttgttcatttgtagtttgtcaggg |
49087376 |
T |
 |
Q |
201 |
gggagatg |
208 |
Q |
|
|
|||||||| |
|
|
T |
49087375 |
gggagatg |
49087368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1339 times since January 2019
Visitors: 1418