View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0113_low_28 (Length: 248)
Name: NF0113_low_28
Description: NF0113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0113_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 25969216 - 25968999
Alignment:
| Q |
1 |
ttcttctaacattcttgtgtaattgtcaaaggctaatattttttgaatgaaatgataggccaatttgagatcttgccggaaaactatgtctcttggtccc |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25969216 |
ttcttctaactttcttgtgtaattgtcaa-ggctaatattttttgaatgaaatgataggccaatttgagaacttgccggaaaactatgtctcttggtccc |
25969118 |
T |
|
| Q |
101 |
actgccaaccacattacatgctagaaaatccggctgttttctgcgaacttccaacttttaacggccatccatcgggtcgggccagatatccgagtcggag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25969117 |
actgccaaccacattacatgctagaaaatccggctgttttctgcgaacttccaacttttaacggccatccatcgggtcgggccagatatccgagtcggag |
25969018 |
T |
|
| Q |
201 |
cagaaacatacccaagaga |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
25969017 |
cagaaacatacccaagaga |
25968999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1657 times since January 2019
Visitors: 1426