View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0113_low_28 (Length: 248)

Name: NF0113_low_28
Description: NF0113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0113_low_28
NF0113_low_28
[»] chr2 (1 HSPs)
chr2 (1-219)||(25968999-25969216)


Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 25969216 - 25968999
Alignment:
1 ttcttctaacattcttgtgtaattgtcaaaggctaatattttttgaatgaaatgataggccaatttgagatcttgccggaaaactatgtctcttggtccc 100  Q
    |||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
25969216 ttcttctaactttcttgtgtaattgtcaa-ggctaatattttttgaatgaaatgataggccaatttgagaacttgccggaaaactatgtctcttggtccc 25969118  T
101 actgccaaccacattacatgctagaaaatccggctgttttctgcgaacttccaacttttaacggccatccatcgggtcgggccagatatccgagtcggag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25969117 actgccaaccacattacatgctagaaaatccggctgttttctgcgaacttccaacttttaacggccatccatcgggtcgggccagatatccgagtcggag 25969018  T
201 cagaaacatacccaagaga 219  Q
    |||||||||||||||||||    
25969017 cagaaacatacccaagaga 25968999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University