View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0113_low_29 (Length: 239)

Name: NF0113_low_29
Description: NF0113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0113_low_29
NF0113_low_29
[»] chr3 (1 HSPs)
chr3 (93-167)||(26643128-26643202)


Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 93 - 167
Target Start/End: Original strand, 26643128 - 26643202
Alignment:
93 aactacatcacgtacacatcattttcacaatatgctattcgaaatttgaagagaatagtttctaattcaagattt 167  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
26643128 aactacatcacgtacacatcattttcacaatatgctattcgaaatttgaagagaatagtttctaattcatgattt 26643202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University