View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0113_low_29 (Length: 239)
Name: NF0113_low_29
Description: NF0113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0113_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 93 - 167
Target Start/End: Original strand, 26643128 - 26643202
Alignment:
Q |
93 |
aactacatcacgtacacatcattttcacaatatgctattcgaaatttgaagagaatagtttctaattcaagattt |
167 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
26643128 |
aactacatcacgtacacatcattttcacaatatgctattcgaaatttgaagagaatagtttctaattcatgattt |
26643202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1496 times since January 2019
Visitors: 1423