View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0113_low_30 (Length: 223)
Name: NF0113_low_30
Description: NF0113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0113_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 55062046 - 55062143
Alignment:
| Q |
1 |
tcgatcaataaatcatagcagggctgtaattttgcgcttttatcggttttcagtgcatgtgcaattttgtttgatatctatccctcatgcgttgtttg |
98 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55062046 |
tcgatcaataaatcatagcggggctgtaattttgcgcttttatcggttttcagtgcatgtgcaatttagtttgatatctatccctcatgcgttgtttg |
55062143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 40932156 - 40932253
Alignment:
| Q |
1 |
tcgatcaataaatcatagcagggctgtaattttgcgcttttatcggttttcagtgcatgtgcaattttgtttgatatctatccctcatgcgttgtttg |
98 |
Q |
| |
|
||||||||| | ||| ||||| ||||| ||||||| |||||||| ||||| |||||||||||||||||||||| ||||| ||||||| ||| |||| |
|
|
| T |
40932156 |
tcgatcaatgagtcacagcagtgctgttattttgcacttttatccattttcgatgcatgtgcaattttgtttgatttctattcctcatgtgttctttg |
40932253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 4 - 87
Target Start/End: Original strand, 40940189 - 40940270
Alignment:
| Q |
4 |
atcaataaatcatagcagggctgtaattttgcgcttttatcggttttcagtgcatgtgcaattttgtttgatatctatccctca |
87 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||| ||||| || ||||||| ||||| ||||| ||||||||||| |
|
|
| T |
40940189 |
atcaataaatcatagcggggctgtcattttgcgcttttatcagtttttgatg-atgtgcacttttg-ttgatttctatccctca |
40940270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1781 times since January 2019
Visitors: 1427