View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0114_high_5 (Length: 251)
Name: NF0114_high_5
Description: NF0114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0114_high_5 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 56 - 251
Target Start/End: Complemental strand, 15936133 - 15935938
Alignment:
Q |
56 |
ttaattattgaaaatatttgattggctgcttttaagggtgaggtgttaggttcggcttcacgtaattagggnnnnnnngtttgttatatccaaaacagta |
155 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
15936133 |
ttaattattgaaaatatttgattggctgcttttaagggtgaggtgttaggttcggcttcacgtaattagggtttttttgtttgttatatccaaaacagta |
15936034 |
T |
 |
Q |
156 |
gggttaaatactcatactcaaatatcacgtaacctaacctaacctgcctgctaaacaaacacaaacagatacaggatgacttccggctccggcaac |
251 |
Q |
|
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
15936033 |
gggttaaatactcatactaaaatatcacgtaacttaacctaacctgcctgctaaacaaacacaaacagatacaggatggcttccggctccggcaac |
15935938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University