View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0114_high_5 (Length: 251)

Name: NF0114_high_5
Description: NF0114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0114_high_5
NF0114_high_5
[»] chr5 (1 HSPs)
chr5 (56-251)||(15935938-15936133)


Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 56 - 251
Target Start/End: Complemental strand, 15936133 - 15935938
Alignment:
56 ttaattattgaaaatatttgattggctgcttttaagggtgaggtgttaggttcggcttcacgtaattagggnnnnnnngtttgttatatccaaaacagta 155  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||    
15936133 ttaattattgaaaatatttgattggctgcttttaagggtgaggtgttaggttcggcttcacgtaattagggtttttttgtttgttatatccaaaacagta 15936034  T
156 gggttaaatactcatactcaaatatcacgtaacctaacctaacctgcctgctaaacaaacacaaacagatacaggatgacttccggctccggcaac 251  Q
    |||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
15936033 gggttaaatactcatactaaaatatcacgtaacttaacctaacctgcctgctaaacaaacacaaacagatacaggatggcttccggctccggcaac 15935938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1353 times since January 2019
Visitors: 1419