View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0114_low_6 (Length: 217)
Name: NF0114_low_6
Description: NF0114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0114_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 48320780 - 48320931
Alignment:
| Q |
1 |
cgttggattgtgaaagtgaaaggagaatgaaaagaatttttcagaatgagatggagattatataagggtgaaagaggtgcaattggcggttaattaccgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48320780 |
cgttggattgtgaaagtgaaaggagaatgaaaagaatttttcagaatgagatggagattatataagggtgaaagaggtgcaattggcggttaattaccgt |
48320879 |
T |
|
| Q |
101 |
ttgaaaatgcatgaagtcgtttcagttgggatttttgaaaaaacgtgattatt |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48320880 |
ttgaaaatgcatgaagtcgtttcagttgggatttttg-aaaaacgtgattatt |
48320931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 71 - 127
Target Start/End: Complemental strand, 26325005 - 26324948
Alignment:
| Q |
71 |
aaagaggtgcaattggcggttaattaccgtttgaaaa-tgcatgaagtcgtttcagtt |
127 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
26325005 |
aaagaggtgcaattgacggttaattaccgttggaaaattgcatgaagtcgtttcagtt |
26324948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1595 times since January 2019
Visitors: 1425