View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0114_low_7 (Length: 216)
Name: NF0114_low_7
Description: NF0114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0114_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 48320804 - 48320679
Alignment:
| Q |
1 |
ctcctttcactttcacaatccaacgaattctgttaaactttcatcggtggcggcgctttcatcttcttctagcgccgctactgccatcatcaccatccca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48320804 |
ctcctttcactttcacaatccaacgaattctgttaaactttcatcagtggcggcgctttcatcttcttctagcgccgctactgccatcatcaccattcca |
48320705 |
T |
|
| Q |
101 |
taattttgtttcaaccaacgtaaatt |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
48320704 |
taattttgtttcaaccaacgtaaatt |
48320679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1432 times since January 2019
Visitors: 1420