View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0115_high_5 (Length: 298)
Name: NF0115_high_5
Description: NF0115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0115_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 2768424 - 2768174
Alignment:
| Q |
1 |
cctaagcctcctcgtactacacataaattacttcaggtaatctcattttaacacttggaagtgctaattgatgaggaaaataaaaactgttatcttcgtt |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2768424 |
cctaagcctcctcgtacgacacataaattacttcaggtaatctcattttaacacttggaagtgctaattgatgaggaaaataaaaactgttatcttcgtt |
2768325 |
T |
 |
| Q |
101 |
aactgatgttaacgtctttcttcagtttatcgtatgctttttaacacccgttgcatcaaagcattataacctataa-ggtataccatcctactttaacat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
2768324 |
aactgatgttaacgtctttcttcagtttatcgtatgctttttaacacccgttgcatcaaagcattataacctataagggtataccatcctactttagcat |
2768225 |
T |
 |
| Q |
200 |
atgtttggatgcgtggctgtaactttttcttgcatccctatgctactccac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2768224 |
atgtttggatgcgtggctgtaactttttcttgcatccctatgctattccac |
2768174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University