View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0115_high_6 (Length: 293)

Name: NF0115_high_6
Description: NF0115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0115_high_6
NF0115_high_6
[»] chr1 (2 HSPs)
chr1 (141-281)||(45623732-45623872)
chr1 (30-89)||(45623924-45623983)


Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 45623872 - 45623732
Alignment:
141 ttgtgaagttacgaagttttggcgcgcttcgatttttgtcggaaacgtgttcgaagaaatgcgtcggtaaagctaaatgcagtacttttttgaggaaggg 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45623872 ttgtgaagttacgaagttttggcgcgcttcgatttttgtcggaaacgtgttcgaagaaatgcgtcggtaaagctaaatgcagtacttttttgaggaaggg 45623773  T
241 taaaaatcacttttgtatatagttcccactttttcgagtat 281  Q
    |||||||||||||||| ||||||||||||||||||||||||    
45623772 taaaaatcacttttgtctatagttcccactttttcgagtat 45623732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 30 - 89
Target Start/End: Complemental strand, 45623983 - 45623924
Alignment:
30 gttttgggttttggggcgaagaaacgggaaagtacttgttgcttttgcttacccatgtta 89  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
45623983 gttttgggttttggagcgaagaaacgggaaagtacttgttgcttttgcttacccatgtta 45623924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University