View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0115_low_4 (Length: 342)
Name: NF0115_low_4
Description: NF0115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0115_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 14 - 294
Target Start/End: Complemental strand, 2768455 - 2768174
Alignment:
| Q |
14 |
agggaaacaagtgcaggatccacccgaggaacctaagcctcctcgtacgacacataaattacttcaggtaatctcattttaacacttggaagtgctaatt |
113 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2768455 |
agggaaacaagtgcaggatccacctgtggaacctaagcctcctcgtacgacacataaattacttcaggtaatctcattttaacacttggaagtgctaatt |
2768356 |
T |
|
| Q |
114 |
gatgaggaaaataaaaactgttatcttcgttaactgatgttaacgtctttcttcagtttatcgtatgctttttaacacccgttgcatcaaagcattataa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2768355 |
gatgaggaaaataaaaactgttatcttcgttaactgatgttaacgtctttcttcagtttatcgtatgctttttaacacccgttgcatcaaagcattataa |
2768256 |
T |
|
| Q |
214 |
cctataa-ggtataccatcctactttaacatatgtttggatgcgtggctgtaactttttcttgcatccctatgctactccac |
294 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2768255 |
cctataagggtataccatcctactttagcatatgtttggatgcgtggctgtaactttttcttgcatccctatgctattccac |
2768174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1598 times since January 2019
Visitors: 1425