View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0115_low_7 (Length: 293)
Name: NF0115_low_7
Description: NF0115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0115_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 141 - 281
Target Start/End: Complemental strand, 45623872 - 45623732
Alignment:
| Q |
141 |
ttgtgaagttacgaagttttggcgcgcttcgatttttgtcggaaacgtgttcgaagaaatgcgtcggtaaagctaaatgcagtacttttttgaggaaggg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45623872 |
ttgtgaagttacgaagttttggcgcgcttcgatttttgtcggaaacgtgttcgaagaaatgcgtcggtaaagctaaatgcagtacttttttgaggaaggg |
45623773 |
T |
|
| Q |
241 |
taaaaatcacttttgtatatagttcccactttttcgagtat |
281 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45623772 |
taaaaatcacttttgtctatagttcccactttttcgagtat |
45623732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 30 - 89
Target Start/End: Complemental strand, 45623983 - 45623924
Alignment:
| Q |
30 |
gttttgggttttggggcgaagaaacgggaaagtacttgttgcttttgcttacccatgtta |
89 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45623983 |
gttttgggttttggagcgaagaaacgggaaagtacttgttgcttttgcttacccatgtta |
45623924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1723 times since January 2019
Visitors: 1426