View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0116-INSERTION-15 (Length: 344)
Name: NF0116-INSERTION-15
Description: NF0116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0116-INSERTION-15 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 52 - 344
Target Start/End: Complemental strand, 49258667 - 49258376
Alignment:
| Q |
52 |
gatttgatccatgcacaatgatttgagaagtaatccagaagaaccg-cttgaacagaaattcagacaaattgctttgaacaatgacccaaatgaaacagt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49258667 |
gatttgatccatgcacaatgatttgagaagtaatccagaagaaccgtcttgaacagaaattcagacaaattgctttgaacaatgacccaaatgaaacagt |
49258568 |
T |
 |
| Q |
151 |
ttgaacaatgatccagatgattttcttcacttcacttattcgatggtccagaagattgacttgagctttatggactttgaccagaacatacggttaaagc |
250 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49258567 |
ttgaacaacgatccagatgattttcttcacttcacttattcgatggtccagaagattgacttgagctttatggactttgaccagaacatacggttaaagc |
49258468 |
T |
 |
| Q |
251 |
ttttgtactaacaaaacttctttttcttcttcaccggagatgagtggattatatatgtgtgagtgaacgtggttatgcagaaactcatcatcat |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49258467 |
ttttgtactaacaaaacttctttttcttcttcaccggagatgagtggatt--atatgtgtgagtgaacgtggttatgcagaaactcatcatcat |
49258376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 58
Target Start/End: Complemental strand, 49258714 - 49258682
Alignment:
| Q |
26 |
tacaaatgcttgaaccaagatgagatgatttga |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49258714 |
tacaaatgcttgaaccaagatgagatgatttga |
49258682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University