View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0116-INSERTION-6 (Length: 497)
Name: NF0116-INSERTION-6
Description: NF0116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0116-INSERTION-6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 3594612 - 3594793
Alignment:
| Q |
1 |
aaaactagagattaattgaatgtttcgcct------------gagtggaattgcaatctagagattgcttaaggaggtactgtgtttgagctgtgatgtg |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3594612 |
aaaactagagattaattgaatgtttcgccttgcctattttacgagtggaattgcaatctagagattgcttaaggaggtactgtgtttgagctgtgatgtg |
3594711 |
T |
|
| Q |
89 |
ctctctggattcacagcggttttgttggttttttaaggcggctgttcagctatttttagtagtgctgctgggagtatttttc |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3594712 |
ctctctggattcacagcggttttgttggttttttaaggcggctgttcagctatttttagtagtgctgctggtagtatttttc |
3594793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 113; E-Value: 5e-57
Query Start/End: Original strand, 162 - 392
Target Start/End: Original strand, 3594977 - 3595230
Alignment:
| Q |
162 |
gtatttttctgctatctggcctgggagggaagtcttttctgtttgtg-------------ttttattggggggttttcttgtctgctgtttgtgcccccc |
248 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3594977 |
gtatttttctgctatctggtctgggagggaagtcttttctgtttgtgaggcccgtttgtgttttattggggggttttcttgtctgctgtttgtgcccccc |
3595076 |
T |
|
| Q |
249 |
nnnnnnnctggtttt----------atggttggggtgtgccgcctatagaaggcaccctgtttgtttttatattgctgtttttgctggcctttgcgcttc |
338 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3595077 |
attttttctggtttttggtggttttatagttggggtgtgccgcctatagaaggcaccctgtttgtttttatattgttgtttttgctggcctttgcgcttc |
3595176 |
T |
|
| Q |
339 |
ttgtgcaagttatacgtagtnnnnnnntttgtttagaaaaaatgaagaattttg |
392 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||||||||||||||| |
|
|
| T |
3595177 |
ttgtgcaagttatatgtagtaaaaatttttgcttagaaaaaatgaagaattttg |
3595230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 8e-22; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 257 - 338
Target Start/End: Original strand, 5179654 - 5179735
Alignment:
| Q |
257 |
tggttttatggttggggtgtgccgcctatagaaggcaccctgtttgtttttatattgctgtttttgctggcctttgcgcttc |
338 |
Q |
| |
|
|||||||||||||||||||| ||||||||| | ||||||||||||| |||| || || |||||||||||||||||||||||| |
|
|
| T |
5179654 |
tggttttatggttggggtgttccgcctatatacggcaccctgtttgattttgtactgttgtttttgctggcctttgcgcttc |
5179735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 165 - 208
Target Start/End: Original strand, 32017317 - 32017361
Alignment:
| Q |
165 |
tttttctgctatctggcctggg-agggaagtcttttctgtttgtg |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| ||||||||| |
|
|
| T |
32017317 |
tttttctgctatctggcctgggaagggaggtctttgctgtttgtg |
32017361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 256 - 345
Target Start/End: Original strand, 23352973 - 23353063
Alignment:
| Q |
256 |
ctggttttatggttggggtgtgccgcctatagaaggcaccctgttt-gtttttatattgctgtttttgctggcctttgcgcttcttgtgca |
345 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| | ||||||| ||| |||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
23352973 |
ctggttttttggttggggtgttccgcctatatacggcacccgattttgtttttctattgttgtttttgatggcctttgcgcttcttgtgca |
23353063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1354 times since January 2019
Visitors: 1419