View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0116-INSERTION-8 (Length: 313)
Name: NF0116-INSERTION-8
Description: NF0116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0116-INSERTION-8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 57; Significance: 8e-24; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 122 - 210
Target Start/End: Complemental strand, 4462135 - 4462047
Alignment:
| Q |
122 |
aaactaagttccctaattaaattcataacagaaatgataaaattccaatattgaacccactaatgtattgcaaaataattatcactagt |
210 |
Q |
| |
|
|||| |||| ||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
4462135 |
aaacaaagtaccctaatgaaattcatagaagaaatgataaaattccaatattgaacccgctgatgtattgcaaaataatcatcactagt |
4462047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 4463654 - 4463542
Alignment:
| Q |
1 |
tcaaacaaatttaaattatattaatac-ttcttttaatatggaaaagaaaatatgattcaacaatatgcacatgttgtatgtctcttgttagacatggtc |
99 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||||||||||||||||||| |||| || ||||||||| | || |||||||||||||| ||||||||| |
|
|
| T |
4463654 |
tcaaacaaatttaaattacattaacgccttcttttaatatggaaaagaaattatgcttaaacaatatgtaaatactgtatgtctcttgtacgacatggtc |
4463555 |
T |
 |
| Q |
100 |
aatgacaaaaaca |
112 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
4463554 |
aatgaaaaaaaca |
4463542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 213 - 258
Target Start/End: Complemental strand, 4461669 - 4461624
Alignment:
| Q |
213 |
taaaaatgtacagaacaaacagagaaagaaacccgtaactgatcca |
258 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||| |||||| |
|
|
| T |
4461669 |
taaaaatgtacaaaacaaacagagaaagaaacccataaccgatcca |
4461624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 313
Target Start/End: Complemental strand, 4461464 - 4461435
Alignment:
| Q |
284 |
caaaatatcacaagactatttccttcttat |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4461464 |
caaaatatcacaagactatttccttcttat |
4461435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University