View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0116-INSERTION-8 (Length: 313)

Name: NF0116-INSERTION-8
Description: NF0116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0116-INSERTION-8
NF0116-INSERTION-8
[»] chr8 (4 HSPs)
chr8 (122-210)||(4462047-4462135)
chr8 (1-112)||(4463542-4463654)
chr8 (213-258)||(4461624-4461669)
chr8 (284-313)||(4461435-4461464)


Alignment Details
Target: chr8 (Bit Score: 57; Significance: 8e-24; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 122 - 210
Target Start/End: Complemental strand, 4462135 - 4462047
Alignment:
122 aaactaagttccctaattaaattcataacagaaatgataaaattccaatattgaacccactaatgtattgcaaaataattatcactagt 210  Q
    |||| |||| ||||||| |||||||||  ||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||    
4462135 aaacaaagtaccctaatgaaattcatagaagaaatgataaaattccaatattgaacccgctgatgtattgcaaaataatcatcactagt 4462047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 4463654 - 4463542
Alignment:
1 tcaaacaaatttaaattatattaatac-ttcttttaatatggaaaagaaaatatgattcaacaatatgcacatgttgtatgtctcttgttagacatggtc 99  Q
    |||||||||||||||||| |||||  | |||||||||||||||||||||| |||| || ||||||||| | ||  ||||||||||||||  |||||||||    
4463654 tcaaacaaatttaaattacattaacgccttcttttaatatggaaaagaaattatgcttaaacaatatgtaaatactgtatgtctcttgtacgacatggtc 4463555  T
100 aatgacaaaaaca 112  Q
    ||||| |||||||    
4463554 aatgaaaaaaaca 4463542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 213 - 258
Target Start/End: Complemental strand, 4461669 - 4461624
Alignment:
213 taaaaatgtacagaacaaacagagaaagaaacccgtaactgatcca 258  Q
    |||||||||||| ||||||||||||||||||||| |||| ||||||    
4461669 taaaaatgtacaaaacaaacagagaaagaaacccataaccgatcca 4461624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 313
Target Start/End: Complemental strand, 4461464 - 4461435
Alignment:
284 caaaatatcacaagactatttccttcttat 313  Q
    ||||||||||||||||||||||||||||||    
4461464 caaaatatcacaagactatttccttcttat 4461435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University