View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0117A11 (Length: 261)
Name: NF0117A11
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0117A11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 7 - 252
Target Start/End: Original strand, 43032425 - 43032670
Alignment:
| Q |
7 |
taataattatttatttaatcttgggtgcagatgatgatgagacatagttgttgtgtcatggtgattgttttgattgggatgttgttgaattggaaagaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43032425 |
taataattatttatttaatcttgggtgcagatgatgatgagacatagttgttgtgtcatggtgattgttttgattgggatgttgttgaattggaaagaaa |
43032524 |
T |
|
| Q |
107 |
cagaagggataagatttgtgatagatagagatgaatgtttctcacatgatgttaagtatgaaggtgacactgttcatgtttcttttgttgttattaaggc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43032525 |
cagaagggataagatttgtgatagatagagatgaatgtttctcacatgatgttaagtatgaaggtgacactgttcatgtttcttttgttgttattaaggc |
43032624 |
T |
|
| Q |
207 |
tgattctccttggcattatggtgatgaaggtgtagatcttgtggta |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43032625 |
tgattctccttggcattatggtgatgaaggtgtagatcttgtggta |
43032670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 170
Target Start/End: Complemental strand, 23623988 - 23623930
Alignment:
| Q |
112 |
gggataagatttgtgatagatagagatgaatgtttctcacatgatgttaagtatgaagg |
170 |
Q |
| |
|
||||| ||||||||||| |||||||| ||||||||||| ||| ||||| | |||||||| |
|
|
| T |
23623988 |
gggattagatttgtgattgatagagaagaatgtttctctcattatgttcaatatgaagg |
23623930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1504 times since January 2019
Visitors: 1423