View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0117A12 (Length: 124)
Name: NF0117A12
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0117A12 |
 |  |
|
[»] scaffold0041 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0041 (Bit Score: 68; Significance: 8e-31; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 68; E-Value: 8e-31
Query Start/End: Original strand, 8 - 75
Target Start/End: Original strand, 79119 - 79186
Alignment:
Q |
8 |
ataacatgggctcaacttggaattcatgacaagccggtaataattgacatgtccaattttcaggaatc |
75 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
79119 |
ataacatgggctcaacttggaattcatgacaagccggtaataattgacatgtccaattttcaggaatc |
79186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 68; Significance: 8e-31; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 8e-31
Query Start/End: Original strand, 8 - 75
Target Start/End: Complemental strand, 40887165 - 40887098
Alignment:
Q |
8 |
ataacatgggctcaacttggaattcatgacaagccggtaataattgacatgtccaattttcaggaatc |
75 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40887165 |
ataacatgggctcaacttggaattcatgacaagccggtaataattgacatgtccaattttcaggaatc |
40887098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1507 times since January 2019
Visitors: 1423