View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0117E27 (Length: 126)
Name: NF0117E27
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0117E27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 13 - 124
Target Start/End: Original strand, 26074015 - 26074126
Alignment:
| Q |
13 |
cccttttaccgtctggtacaaaatgatcccaagcacgagaacgtttacgagtttttccgacatcacctgccgcttcaccttgtaagtcatgatcagaatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26074015 |
cccttttaccgtctggtacaaaatgatcccaagcacgagaacgtttacgattttttccgacgtcacctgccgcttcaccttgtaagtcatgatcagaatc |
26074114 |
T |
 |
| Q |
113 |
aacatcaattgg |
124 |
Q |
| |
|
|||||||||||| |
|
|
| T |
26074115 |
aacatcaattgg |
26074126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 104; Significance: 3e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 13 - 124
Target Start/End: Original strand, 44272791 - 44272902
Alignment:
| Q |
13 |
cccttttaccgtctggtacaaaatgatcccaagcacgagaacgtttacgagtttttccgacatcacctgccgcttcaccttgtaagtcatgatcagaatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44272791 |
cccttttaccgtctggtacaaaatgatcccaagcacgagaacgtttacgattttttccgacgtcacctgccgcttcaccttgtaagtcatgatcagaatc |
44272890 |
T |
 |
| Q |
113 |
aacatcaattgg |
124 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44272891 |
aacatcaattgg |
44272902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 100; E-Value: 7e-50
Query Start/End: Original strand, 13 - 124
Target Start/End: Complemental strand, 1669688 - 1669577
Alignment:
| Q |
13 |
cccttttaccgtctggtacaaaatgatcccaagcacgagaacgtttacgagtttttccgacatcacctgccgcttcaccttgtaagtcatgatcagaatc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1669688 |
cccttttaccgtctggtacaaaatgatcccaagcacgagaacgcttacgattttttccgacgtcacctgccgcttcaccttgtaagtcatgatcagaatc |
1669589 |
T |
 |
| Q |
113 |
aacatcaattgg |
124 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1669588 |
aacatcaattgg |
1669577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University