View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0117E3 (Length: 110)
Name: NF0117E3
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0117E3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 1e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 4 - 102
Target Start/End: Complemental strand, 35341278 - 35341180
Alignment:
| Q |
4 |
caattggtccttggtgtatgatgcagatggagaggaatgtatctacattatttgtgatgttgatatttactcttattttttctctatctgaagggctta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35341278 |
caattggtccttggtgtatgatgcagatggagaggaatgtatctacattatttgtggtgttgatatttactcttattttctctctatctgaagggctta |
35341180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1348 times since January 2019
Visitors: 1419