View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0117_high_26 (Length: 290)
Name: NF0117_high_26
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0117_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 23 - 242
Target Start/End: Original strand, 2202735 - 2202954
Alignment:
Q |
23 |
cacagaggaaaacattattactaggatcatagatacatttgaattgtatctcgatttaaaacaaaaactgaactcaacgaatatgaatcgttggtgtgta |
122 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
2202735 |
cacagaggaaaacattattattaggatcatagatacatttgaattgtatctcgatttaaaacaaaaactgaacacaacgaatatgaatcgttggtgtgta |
2202834 |
T |
 |
Q |
123 |
tcatttttggacatgaatccagattcatcaagataaatcctgtttcacaagacatgaattcagaatcattaagatggatcctaattcattcagataaatc |
222 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
2202835 |
tcatttttggacatgaatccagattcatcaagataaatcctgtttcacaagacatgaattcagaatcattaagatagatcctaattcattcagataaatc |
2202934 |
T |
 |
Q |
223 |
ctgattcactatgataaatc |
242 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
2202935 |
ctgattcactatgataaatc |
2202954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University