View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0117_high_28 (Length: 282)
Name: NF0117_high_28
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0117_high_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 7e-55; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 19756240 - 19756112
Alignment:
Q |
1 |
caccacacatacatcataaatgctatacaatcgttagtgttgatcatattggcaaggattcaacacatacatcataatgaagtaagtttggactcttttg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||| ||| ||||||| |
|
|
T |
19756240 |
caccacacatacatcataaatgctatacaatccttagtgttgatcatattggcaagaattcaacacatacatcataatgaagtgagttcggattcttttg |
19756141 |
T |
 |
Q |
101 |
ttgatatgagaatctcattaatacttgaa |
129 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
19756140 |
ttgatatgagaatctcattaatacttgaa |
19756112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 204 - 270
Target Start/End: Complemental strand, 19756050 - 19755984
Alignment:
Q |
204 |
agtctgtttccttaggcgtgtaagtacatttgtaaatacactttgagacaattaaccacatgatttt |
270 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
19756050 |
agtctgtttccttaggcgtgtaagtacatttgtaaatacactttgagactattaaccacatgatttt |
19755984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 5 - 126
Target Start/End: Complemental strand, 24133999 - 24133884
Alignment:
Q |
5 |
acacatacatcataaatgctatacaatcgttagtgttgatcatattggcaaggattcaacacatacatcataatgaagtaagtttggactcttttgttga |
104 |
Q |
|
|
||||| ||||||| |||| |||| || || | |||||||| |||||||||||||||||||||||||||||||| |||| ||| |||||||| | |
|
|
T |
24133999 |
acacaaacatcatcaatgttataagattgtcaatgttgatcctattggcaaggattcaacacatacatcataattaagtgagt------tcttttgtcaa |
24133906 |
T |
 |
Q |
105 |
tatgagaatctcattaatactt |
126 |
Q |
|
|
|||||||||||||||| ||||| |
|
|
T |
24133905 |
tatgagaatctcattagtactt |
24133884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1967 times since January 2019
Visitors: 1435