View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0117_high_33 (Length: 262)
Name: NF0117_high_33
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0117_high_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 36 - 260
Target Start/End: Original strand, 6982104 - 6982327
Alignment:
Q |
36 |
ccatgcttccttggaagatacaacatcaccaactctttcgaaattttcatgattcatgcattgatgggtgatgaacaaattcttgtattatttcttcttg |
135 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
T |
6982104 |
ccatgcttccttggaagatacaacatcaccaactctttcgaaattttcatgattcatgcattgatgggtgatgaacaaagtcttgtagtatttcttcttc |
6982203 |
T |
 |
Q |
136 |
gcttcgttgcgtgcaactctttgtgcttatgttggattctctctaaggggatcaaactctgaatttcactaaatctcgtgcatcttgataccagaacacc |
235 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6982204 |
gcttcgttgtgtgcaactctttgtgcttatgttggattctctctaaggggatc-aactccgaatttcactaaatctcgtgcatcttgataccagaacacc |
6982302 |
T |
 |
Q |
236 |
atcttcatttgcttgcaccatttat |
260 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
6982303 |
atcttcatttgcttgcaccatttat |
6982327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 29 - 80
Target Start/End: Complemental strand, 36112256 - 36112205
Alignment:
Q |
29 |
agatatcccatgcttccttggaagatacaacatcaccaactctttcgaaatt |
80 |
Q |
|
|
|||| ||||| |||||||| |||||| ||||||||||||||||||| ||||| |
|
|
T |
36112256 |
agatgtcccaagcttcctttgaagattcaacatcaccaactctttcaaaatt |
36112205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University