View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0117_high_34 (Length: 258)
Name: NF0117_high_34
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0117_high_34 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 177 - 250
Target Start/End: Original strand, 3683245 - 3683318
Alignment:
| Q |
177 |
caactaaattaactagtaccatctcttaattactctataataatctaaacatattaattattattattccctca |
250 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3683245 |
caactaaattaactagtaccatctcataattactctataataatctaaacatattaattattattattccctca |
3683318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 91 - 132
Target Start/End: Original strand, 3683158 - 3683199
Alignment:
| Q |
91 |
gttaacccagaagttgatcatcatcattatcataataatctc |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3683158 |
gttaacccagaagttgatcatcatcattatcataataatctc |
3683199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1981 times since January 2019
Visitors: 1435