View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0117_high_43 (Length: 226)
Name: NF0117_high_43
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0117_high_43 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 23282848 - 23282626
Alignment:
| Q |
7 |
atatcctcgatcaatcactcttaatttgccacaacatgtctctcaaaaccttactgcaa-caattgctaattttattcatgaaggtcaat--ggaacatt |
103 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| ||| || ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23282848 |
atatcctcgatcaatcactcttaattttccacaacatgtctctcaaaacctcactccaaacagttgctaattttattcatgaaggtcaatatggaacatc |
23282749 |
T |
|
| Q |
104 |
cctcaagtagttcaagcagctttccctaatatgagatttcttgttcaacaagtagcccttcctattgaatataaacatgacaagttgatatggaaaaact |
203 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| ||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
23282748 |
cctcaagtagttcaagtagctttccctaatatgagatttcttgttcaacaagtaacccttcttattgaagataaatatgacaagttgatatggaaaaact |
23282649 |
T |
|
| Q |
204 |
ccattacaggagatctaacattt |
226 |
Q |
| |
|
| |||||||||| ||||||||| |
|
|
| T |
23282648 |
ctcttacaggagagctaacattt |
23282626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2057 times since January 2019
Visitors: 1439