View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0117_low_25 (Length: 353)
Name: NF0117_low_25
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0117_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 141 - 262
Target Start/End: Original strand, 4599892 - 4600013
Alignment:
| Q |
141 |
tcagagtctaagatatgtttattttaaaatggaatgattccaagtaatacaatttgagccttatcctcattgtgacaaagattgatcttgaatcctctca |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4599892 |
tcagagtctaagatatgtttattttaaaatggaatgattccaagtaatacaatttgagccttatcctcattgtgacaaagattgatcttgaatcctctca |
4599991 |
T |
|
| Q |
241 |
ataatcgatgtatactagtcta |
262 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
4599992 |
ataatcgatgcatactagtcta |
4600013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 4599769 - 4599848
Alignment:
| Q |
18 |
atgaagtatagagaaaatgagaaagggatgagtcaatggtttaataattgagataaaagccaatgtcccttggatttgtg |
97 |
Q |
| |
|
||||||||||||||||||||||||||| | |||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4599769 |
atgaagtatagagaaaatgagaaaggggtatgtcagtggtttaataattgagataaaagccaatgtcccttagatttgtg |
4599848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1689 times since January 2019
Visitors: 1426