View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0117_low_27 (Length: 338)
Name: NF0117_low_27
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0117_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 25524592 - 25524347
Alignment:
| Q |
1 |
attggatttgctcctgcacctgggaggtattttactttacattcatatactgtcttatgacnnnnnnnnctgtcttcttttaaaactcatacatactctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
25524592 |
attggatttgctcctgcacctgggaggtattttactttacattcatatactctcttatgacttttttt-ctgtcttcttttaaa-ctaatacatactctt |
25524495 |
T |
|
| Q |
101 |
ggcattccggttaatatttcaggttcttccgctacatgcttttattgcttatggtgcaccaaatggcattaggtctctttcggctcacggctgctatcgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25524494 |
ggcattccggttaatatttcaggttcttccgctacatgcttttattgcttatggtgcaccaaatggcattaggtctctttcggctcacagctgctatcgg |
25524395 |
T |
|
| Q |
201 |
acgcgatatggttgttgctaatacaggtggatcgggtgtactgatgat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25524394 |
acgcgatatggttgttgctaatacaggtggatcgggtgtactgatgat |
25524347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1820 times since January 2019
Visitors: 1430