View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0117_low_29 (Length: 337)

Name: NF0117_low_29
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0117_low_29
NF0117_low_29
[»] chr1 (1 HSPs)
chr1 (116-241)||(30417173-30417298)


Alignment Details
Target: chr1 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 116 - 241
Target Start/End: Complemental strand, 30417298 - 30417173
Alignment:
116 aacctgtgctgcctttgctttgatcaattccttttcaaatattaatgttgttgttgttatccagggagacattccactgcagggagacttctctgctgaa 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30417298 aacctgtgctgcctttgctttgatcaattccttttcaaatattaatgttgttgttgttatccagggagacattccactgcagggagacttctctgctgaa 30417199  T
216 catatgatattcggtggtgggttttc 241  Q
    ||||||||||||||||||||||||||    
30417198 catatgatattcggtggtgggttttc 30417173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University