View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0117_low_30 (Length: 330)
Name: NF0117_low_30
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0117_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 7e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 21 - 133
Target Start/End: Complemental strand, 22361523 - 22361411
Alignment:
Q |
21 |
cctaattcacctggcaagtcagttttcactctaagccatttttgtaggttaaggtatgtcttgactgacttactaaatttgtttactgccattaatactg |
120 |
Q |
|
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
T |
22361523 |
cctaattcaccttgcaagtcagttttcactgtaagccatttttgtaggttcaggtatgtcttgattgacttgctaaatttgtttactgccattaatactg |
22361424 |
T |
 |
Q |
121 |
gtgtcgttgtttt |
133 |
Q |
|
|
|||||||||||| |
|
|
T |
22361423 |
atgtcgttgtttt |
22361411 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 239
Target Start/End: Original strand, 11190532 - 11190578
Alignment:
Q |
193 |
taaaactaaatttatagtacaagaagatggaaggagaaggagagaaa |
239 |
Q |
|
|
||||||||||||||| ||||||||||||||| || |||||||||||| |
|
|
T |
11190532 |
taaaactaaatttatggtacaagaagatggagggggaaggagagaaa |
11190578 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University
This website was viewed 10001 times since January 2019
Visitors: 9952