View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0117_low_30 (Length: 330)

Name: NF0117_low_30
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0117_low_30
NF0117_low_30
[»] chr4 (2 HSPs)
chr4 (21-133)||(22361411-22361523)
chr4 (193-239)||(11190532-11190578)


Alignment Details
Target: chr4 (Bit Score: 89; Significance: 7e-43; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 21 - 133
Target Start/End: Complemental strand, 22361523 - 22361411
Alignment:
21 cctaattcacctggcaagtcagttttcactctaagccatttttgtaggttaaggtatgtcttgactgacttactaaatttgtttactgccattaatactg 120  Q
    |||||||||||| ||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||    
22361523 cctaattcaccttgcaagtcagttttcactgtaagccatttttgtaggttcaggtatgtcttgattgacttgctaaatttgtttactgccattaatactg 22361424  T
121 gtgtcgttgtttt 133  Q
     ||||||||||||    
22361423 atgtcgttgtttt 22361411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 239
Target Start/End: Original strand, 11190532 - 11190578
Alignment:
193 taaaactaaatttatagtacaagaagatggaaggagaaggagagaaa 239  Q
    ||||||||||||||| ||||||||||||||| || ||||||||||||    
11190532 taaaactaaatttatggtacaagaagatggagggggaaggagagaaa 11190578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University