View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0117_low_37 (Length: 265)
Name: NF0117_low_37
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0117_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 39944800 - 39945003
Alignment:
| Q |
1 |
aatagcagttttgctgcaattcttttatgtatgtgttgattttacaagtataacta----tatataacaacttgaaattgggtaattaattaataggtg- |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39944800 |
aatagcagttttgctgcaattcttttatgtatgtgttgattttacaagtataactaactatatataacaacttgaaattgggtaattaattaataggtgg |
39944899 |
T |
 |
| Q |
96 |
attgtagggtgaggctctaacaagtccctcaccttaaaccattattaagagtcgttggattaataagttctactagattgcataatgaactctacacacc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39944900 |
attgtagggtgaggctctaacaagtccctcaccttaaaccatcattaagagtcgttggattaataagttctactagattgtataatgaactctacacacc |
39944999 |
T |
 |
| Q |
196 |
actg |
199 |
Q |
| |
|
|||| |
|
|
| T |
39945000 |
actg |
39945003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University