View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0117_low_41 (Length: 258)

Name: NF0117_low_41
Description: NF0117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0117_low_41
NF0117_low_41
[»] chr6 (2 HSPs)
chr6 (177-250)||(3683245-3683318)
chr6 (91-132)||(3683158-3683199)


Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 177 - 250
Target Start/End: Original strand, 3683245 - 3683318
Alignment:
177 caactaaattaactagtaccatctcttaattactctataataatctaaacatattaattattattattccctca 250  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
3683245 caactaaattaactagtaccatctcataattactctataataatctaaacatattaattattattattccctca 3683318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 91 - 132
Target Start/End: Original strand, 3683158 - 3683199
Alignment:
91 gttaacccagaagttgatcatcatcattatcataataatctc 132  Q
    ||||||||||||||||||||||||||||||||||||||||||    
3683158 gttaacccagaagttgatcatcatcattatcataataatctc 3683199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University