View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0118_high_3 (Length: 350)
Name: NF0118_high_3
Description: NF0118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0118_high_3 |
 |  |
|
[»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 249 - 350
Target Start/End: Original strand, 55319 - 55420
Alignment:
Q |
249 |
attggctaattgaagcatcctctacagtttttcaactgtctagcaaaaaccaatctagaattgggaacctaaaatacgtatggaagaaccttcaggtgga |
348 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
55319 |
attggctaattgaagcatcctctacagtttttcaactgtctagcaaaaaccaatctagaattgggaacctaaaatacctatggaagaaccttcaggtgga |
55418 |
T |
 |
Q |
349 |
ca |
350 |
Q |
|
|
|| |
|
|
T |
55419 |
ca |
55420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 22 - 84
Target Start/End: Original strand, 55260 - 55322
Alignment:
Q |
22 |
catcatcaattatatttaatagaaattgtggtagtagtaaacacaaatgttatagaactattg |
84 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
55260 |
catcatcaattatatttaatagaaattgtggtagtagcaaacacaaatgttatagaactattg |
55322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 176 - 283
Target Start/End: Original strand, 33754949 - 33755056
Alignment:
Q |
176 |
taatggatttgcagcttatgcgtcctaaaaaggttacattctacaaaatagtttttgtaagaaagttaaaatcattggctaattgaagcatcctctacag |
275 |
Q |
|
|
||||| |||||||||||||||| |||||||||| |||| ||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
33754949 |
taatgtatttgcagcttatgcgccctaaaaaggctacaacttaccgactagtttttgtaagaaagttaaaatctttggctaattgaagcatcctctacag |
33755048 |
T |
 |
Q |
276 |
tttttcaa |
283 |
Q |
|
|
|||||||| |
|
|
T |
33755049 |
tttttcaa |
33755056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1617 times since January 2019
Visitors: 1426