View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0118_low_5 (Length: 252)
Name: NF0118_low_5
Description: NF0118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0118_low_5 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 29 - 252
Target Start/End: Original strand, 41095238 - 41095461
Alignment:
Q |
29 |
agcacacagtagatctctggattagnnnnnnnagtaagatgtgtattttgtgttcagtggatgaatttgtaatagcagaatgactgactatggtcattat |
128 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41095238 |
agcacacagtagatctctggattagtttttttagtaagatgtgtattttgtgttcagtagatgaatttgtaatagcagaatgactgactatggtcattat |
41095337 |
T |
 |
Q |
129 |
tatgattatgatgataattaattttctttcataacataacatcccaaacagaaaatttatccatnnnnnnncttcaagttaaatcatagttaactcatgc |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
41095338 |
tatgattatgatgataattaattttctttcataacataacatcccaaacagaaaatttatccataaaaaaacttcaagttaaatcatagttaactcatgc |
41095437 |
T |
 |
Q |
229 |
tagtaataatgtttaagttgttgc |
252 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
41095438 |
tagtaataatgtttaagttgttgc |
41095461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University