View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0118_low_6 (Length: 251)
Name: NF0118_low_6
Description: NF0118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0118_low_6 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 41095720 - 41095480
Alignment:
| Q |
12 |
atgaatgttaataaaagttggtaaattaataaacaagttatannnnnnnnn---gagggacaataacaagttatatgttgatcgaaagtttattatggtc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41095720 |
atgaatgttaataaaagttggtaaattaataaacaagttatattttttttttttgagggacaataacaagttatatgttgatcgaacgtttattatggtc |
41095621 |
T |
 |
| Q |
109 |
attctatatgatttacacatgattgtggtgtgattatcatgtgaagaccaacatttcatatatgcaacgatgtgtggatcttgttcaaagttatctcgat |
208 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41095620 |
attctatatgatttaca--tgattgtggtgtgattatcacgtgaagaccaacatttcatatatgcaacgatgtgtggatcttgctcaaagttatctcgat |
41095523 |
T |
 |
| Q |
209 |
cgatgtaatgccagaaactaggttgggtgcatccaacttggat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41095522 |
cgatgtaatgccagaaactaggttgggtgcatccaacttggat |
41095480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University