View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0118_low_7 (Length: 216)
Name: NF0118_low_7
Description: NF0118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0118_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 19756032 - 19755831
Alignment:
Q |
1 |
tgtaagtacatttgtaaatacactgtgagacaattaaccacatgattttttcgacaggatcgaaagaggaaaggaacttctacttctgagtcttcttcga |
100 |
Q |
|
|
|||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
19756032 |
tgtaagtacatttgtaaatacactttgagactattaaccacatgattttttcgacaggatcgaaagaggaaaggaacttctacttctgagccttcttcga |
19755933 |
T |
 |
Q |
101 |
aaaagacgaaacagagtggagaagaagtaaattctttacacctttgtgtgcattggtattttcttttcaaaatttactaacaccaaatttttcttctagt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
T |
19755932 |
aaaagacgaaacagagtggagaagaagtaagttctttacacatttgtgtgcattggtattttctttccaaaatttactaacaccaattttttcttctagt |
19755833 |
T |
 |
Q |
201 |
cc |
202 |
Q |
|
|
|| |
|
|
T |
19755832 |
cc |
19755831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1616 times since January 2019
Visitors: 1426