View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0119_low_1 (Length: 522)
Name: NF0119_low_1
Description: NF0119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0119_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 1e-79; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 313 - 510
Target Start/End: Complemental strand, 38945227 - 38945028
Alignment:
| Q |
313 |
ttgttgaactctgtcttgcggtgaaatctctatactgccccatgccctttcaatatatatacgtgattgtt---tagttgttgtgatcagtttgtagttc |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| ||||| ||||||||||||| ||||| |
|
|
| T |
38945227 |
ttgttgaactctgtcttgcggtgaaatctctatactaccccatgccctttcaatatatatacgtt-ttgttccgtagtttctgtgatcagtttgcagttc |
38945129 |
T |
|
| Q |
410 |
cactttcgttcttcacatctctcatatctgtgtgtggaatttttgtttctgagatccagttccattttctgtgatggagaactcctttgattcgttgtct |
509 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38945128 |
cactttcgttcttcacatctctcatatctgtgtgtataatttttgtttctgagatccagttccattttctgtgatggagaactcctttgattcgttgtct |
38945029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 113; E-Value: 5e-57
Query Start/End: Original strand, 29 - 157
Target Start/End: Complemental strand, 38945462 - 38945334
Alignment:
| Q |
29 |
atttatcctgtagatcaacattctggtgggatcgatgcaatttcatttcgagtgccgtaaattcccgtggctaccccatgtgattgaatttgtttgtatg |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38945462 |
atttatcctgtagatcaacattctggtgggatcgatgcaatttaatttcgagtgccgtcaattctcgtggctaccccatgtgattgaatttgtttgtatg |
38945363 |
T |
|
| Q |
129 |
tggattttcggcgtaaggcatggttgtct |
157 |
Q |
| |
|
|||||||||||||| |||||||||||||| |
|
|
| T |
38945362 |
tggattttcggcgtgaggcatggttgtct |
38945334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 189 - 228
Target Start/End: Complemental strand, 38945339 - 38945300
Alignment:
| Q |
189 |
ttgtctttattgaagaatccagcgtgtttgtacgtcatct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38945339 |
ttgtctttattgaagaatccagcgtgtttgtacgtcatct |
38945300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 457 - 508
Target Start/End: Complemental strand, 42384711 - 42384661
Alignment:
| Q |
457 |
tctgagatccagttccattttctgtgatggagaactcctttgattcgttgtc |
508 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
42384711 |
tctgatatccagttccagttt-tgtgatggagaactcctttgatttgttgtc |
42384661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 457 - 508
Target Start/End: Complemental strand, 1749804 - 1749754
Alignment:
| Q |
457 |
tctgagatccagttccattttctgtgatggagaactcctttgattcgttgtc |
508 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
1749804 |
tctgatatccagttccagttt-tgtgatggagaactcctttgatttgttgtc |
1749754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2580 times since January 2019
Visitors: 7219