View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0121_low_7 (Length: 266)
Name: NF0121_low_7
Description: NF0121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0121_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 43 - 244
Target Start/End: Complemental strand, 39834691 - 39834490
Alignment:
Q |
43 |
agcaacatagtatatccgagcctgcaatgccactcctcccctcccactcaaggaatcaaagctgacttgtcatcttagcatcaataatattaattgatga |
142 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
39834691 |
agcaacatagtatatccgagcctgcaatgccactcctcccctcccactcaaggaatcaaagctgacttgtcatcttagcatcaataatattagttgatga |
39834592 |
T |
 |
Q |
143 |
tttatttaaatcttaagatagcaattaacacctttagttaaccatgaagcccacttaagtcattttataattgtattaacatgatccacttcttctgtgc |
242 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
39834591 |
tttatttaaatcttaagatagcaattaacacctttagttaaccatgaagcccacttaagtcattttataattgtattaacacgatccacttcttctgtgc |
39834492 |
T |
 |
Q |
243 |
tc |
244 |
Q |
|
|
|| |
|
|
T |
39834491 |
tc |
39834490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 97 - 223
Target Start/End: Complemental strand, 39824314 - 39824186
Alignment:
Q |
97 |
atcaaagctgacttgtcatcttagcatcaataatattaattgatgatttatttaaatcttaagatagcaattaacacctttagttaacc---atgaagcc |
193 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||| | | ||| || ||||||||||| |||||||| |||||| |||||||| |
|
|
T |
39824314 |
atcaaagctgacttgtcatcttagcatcaataatattaattaatgatttctat-aatgttgggatagcaattagcacctttaattaaccatgatgaagcc |
39824216 |
T |
 |
Q |
194 |
cacttaagtcattttataattgtattaaca |
223 |
Q |
|
|
||||| |||||||||||||||||||||||| |
|
|
T |
39824215 |
cacttcagtcattttataattgtattaaca |
39824186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1826 times since January 2019
Visitors: 1430