View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0122_high_10 (Length: 251)
Name: NF0122_high_10
Description: NF0122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0122_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 24879588 - 24879828
Alignment:
Q |
1 |
atttcttggtcctgatcaaattcatgatgcagacttgttaattggtaattggagcccttttgattttccaagggatgcttaaatgattctcttcatatat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24879588 |
atttcttggtcctgatcaaattcatgatgcagacttgttaattggtaattggagcccttttgattttccaagggatgcttaaatgattctcttcatatat |
24879687 |
T |
 |
Q |
101 |
ttggtgcaaatcgggtatcctctttacgcaactgcaaagactaatccttcgaatcgggtaagactgcaaagactaaccctcgagtcgggtaggactacaa |
200 |
Q |
|
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
24879688 |
ttggtgcaaatcgggtatcctctatacgcaactgcgaagactaatccttcgagtcgggtaagactgcaaagactaaccctcgagtcggataggactacaa |
24879787 |
T |
 |
Q |
201 |
tggactactgatcagggctcaattctaacccaagacctttg |
241 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
24879788 |
tggactgctgatcagggctcaattctaacccaagacctttg |
24879828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 152
Target Start/End: Complemental strand, 40294779 - 40294727
Alignment:
Q |
100 |
tttggtgcaaatcgggtatcctctttacgcaactgcaaagactaatccttcga |
152 |
Q |
|
|
||||||| |||||||||||||| | | ||||||||| ||||||||||||||| |
|
|
T |
40294779 |
tttggtgtaaatcgggtatcctttgtgcgcaactgcggagactaatccttcga |
40294727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University