View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0122_high_13 (Length: 238)
Name: NF0122_high_13
Description: NF0122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0122_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 181
Target Start/End: Complemental strand, 36896952 - 36896789
Alignment:
Q |
18 |
ttcttctggttcaaagaaaggaagaggtgggtcagttcaacattctcaaccacctaggtgtcaagttgaaggatgtaaactagatctgactgatgctaaa |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36896952 |
ttcttctggttcaaagaaaggaagaggtgggtcagttcaacattctcaaccacctaggtgtcaagttgaaggatgtaaactagatctgactgatgctaaa |
36896853 |
T |
 |
Q |
118 |
gcttactattctagacacaaagtttgtagcatgcactctaaatcccctactgttactgtctctg |
181 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
36896852 |
gcttactattctagacacaaagtttgtagcatgcactctaaatcccctactgttactgtttctg |
36896789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 67 - 171
Target Start/End: Complemental strand, 22682327 - 22682223
Alignment:
Q |
67 |
ccacctaggtgtcaagttgaaggatgtaaactagatctgactgatgctaaagcttactattctagacacaaagtttgtagcatgcactctaaatccccta |
166 |
Q |
|
|
||||||||||||||||||||||| |||||| ||||||||| || |||||| ||||| ||||||||||| ||||||||| ||||||| || ||||| ||| |
|
|
T |
22682327 |
ccacctaggtgtcaagttgaaggttgtaaagtagatctgagtggtgctaaggcttattattctagacataaagtttgttgcatgcattcaaaatctcctt |
22682228 |
T |
 |
Q |
167 |
ctgtt |
171 |
Q |
|
|
||||| |
|
|
T |
22682227 |
ctgtt |
22682223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1912 times since January 2019
Visitors: 1433