View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0122_high_20 (Length: 213)
Name: NF0122_high_20
Description: NF0122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0122_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 29 - 192
Target Start/End: Original strand, 36896789 - 36896952
Alignment:
| Q |
29 |
cagagacagtaacagtaggggatttagagtgcatgctacaaactttgtgtctagaatagtaagctttagcatcagtcagatctagtttacatccttcaac |
128 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36896789 |
cagaaacagtaacagtaggggatttagagtgcatgctacaaactttgtgtctagaatagtaagctttagcatcagtcagatctagtttacatccttcaac |
36896888 |
T |
 |
| Q |
129 |
ttgacacctaggtggttgagaatgttgaactgacccacctcttcctttctttgaaccagaagaa |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36896889 |
ttgacacctaggtggttgagaatgttgaactgacccacctcttcctttctttgaaccagaagaa |
36896952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 39 - 143
Target Start/End: Original strand, 22682223 - 22682327
Alignment:
| Q |
39 |
aacagtaggggatttagagtgcatgctacaaactttgtgtctagaatagtaagctttagcatcagtcagatctagtttacatccttcaacttgacaccta |
138 |
Q |
| |
|
||||| ||| ||||| || ||||||| ||||||||| ||||||||||| ||||| |||||| || ||||||||| |||||| |||||||||||||||||| |
|
|
| T |
22682223 |
aacagaaggagattttgaatgcatgcaacaaactttatgtctagaataataagccttagcaccactcagatctactttacaaccttcaacttgacaccta |
22682322 |
T |
 |
| Q |
139 |
ggtgg |
143 |
Q |
| |
|
||||| |
|
|
| T |
22682323 |
ggtgg |
22682327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University