View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0122_low_10 (Length: 295)
Name: NF0122_low_10
Description: NF0122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0122_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 58 - 221
Target Start/End: Original strand, 36896789 - 36896952
Alignment:
Q |
58 |
cagagacagtaacagtaggggatttagagtgcatgctacaaactttgtgtctagaatagtaagctttagcatcagtcagatctagtttacatccttcaac |
157 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36896789 |
cagaaacagtaacagtaggggatttagagtgcatgctacaaactttgtgtctagaatagtaagctttagcatcagtcagatctagtttacatccttcaac |
36896888 |
T |
 |
Q |
158 |
ttgacacctaggtggttgagaatgttgaactgacccacctcttcctttctttgaaccagaagaa |
221 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36896889 |
ttgacacctaggtggttgagaatgttgaactgacccacctcttcctttctttgaaccagaagaa |
36896952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 68 - 172
Target Start/End: Original strand, 22682223 - 22682327
Alignment:
Q |
68 |
aacagtaggggatttagagtgcatgctacaaactttgtgtctagaatagtaagctttagcatcagtcagatctagtttacatccttcaacttgacaccta |
167 |
Q |
|
|
||||| ||| ||||| || ||||||| ||||||||| ||||||||||| ||||| |||||| || ||||||||| |||||| |||||||||||||||||| |
|
|
T |
22682223 |
aacagaaggagattttgaatgcatgcaacaaactttatgtctagaataataagccttagcaccactcagatctactttacaaccttcaacttgacaccta |
22682322 |
T |
 |
Q |
168 |
ggtgg |
172 |
Q |
|
|
||||| |
|
|
T |
22682323 |
ggtgg |
22682327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1686 times since January 2019
Visitors: 1426