View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0122_low_13 (Length: 253)
Name: NF0122_low_13
Description: NF0122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0122_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 29010107 - 29009865
Alignment:
| Q |
1 |
aaccctattttttatgtacagatttgtagactgggatagttacatgtttaactagaagannnnnnnnnnnnnnnnnnnnnncatccctttgcataaacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29010107 |
aaccctattttttatgtacagatttgtagactgggatagttacatgtttaactagaagatttttttttcctttctttttt-catccctttgcataaacaa |
29010009 |
T |
|
| Q |
101 |
aattttgtggttaaccttactctacaaggcctattttgtttactttcatcatactatcacaccaccaaggccaagctcatcttcaatgtcatctccatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29010008 |
aattttgtggttaaccttactctacaaggcctattttgtttacttccatcatactatcacaccaccaaggccaagctcatcttcaatgtcatctccatct |
29009909 |
T |
|
| Q |
201 |
tcaaataacttcaaaaaatgagcttggtcctcttcttttctttt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29009908 |
tcaaataacttcaaaaaatgagcttggtcctcttcttttctttt |
29009865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 217
Target Start/End: Complemental strand, 40372992 - 40372940
Alignment:
| Q |
165 |
ccaaggccaagctcatcttcaatgtcatctccatcttcaaataacttcaaaaa |
217 |
Q |
| |
|
|||||||| |||||||| ||||||||||| || || ||||||||||||||||| |
|
|
| T |
40372992 |
ccaaggccgagctcatcctcaatgtcatcaccttcatcaaataacttcaaaaa |
40372940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1859 times since January 2019
Visitors: 1430