View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0122_low_15 (Length: 252)
Name: NF0122_low_15
Description: NF0122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0122_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 4 - 224
Target Start/End: Original strand, 29010124 - 29010350
Alignment:
Q |
4 |
gtttttgctcaacaatccaatagaaacaaataagcaagatatcaataaaactcacggatagcatcaattttattggcattatgatt-----gacactata |
98 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
29010124 |
gtttttgctcaacaatccaatagaaacaaataagcaagatatcaataaaactcacggatagcatcaattttattggcattatgattttgaggacactata |
29010223 |
T |
 |
Q |
99 |
gtcgcctagtcagtgttcgtgtctccggcaagtgttcagaccctggttgtcgc-acgtaaaagaagatagtaactactgcaaactgtagtgcatcaacgt |
197 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
29010224 |
gtcgcctagtcagtgtttgtgtctccggcaagtgttcagaccctggttgtcgctacgtaaaagaagatagtaactactgcaaactgtagtgcgtcaacgt |
29010323 |
T |
 |
Q |
198 |
aataataatcataatcataacaaagat |
224 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
29010324 |
aataataatcataatcataacaaagat |
29010350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University