View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0122_low_21 (Length: 235)
Name: NF0122_low_21
Description: NF0122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0122_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 214
Target Start/End: Original strand, 40763671 - 40763871
Alignment:
Q |
14 |
gctgttgctcggattgggaatgctcttgcttatgctacacatacatttttcaacaagcatgggtttctttatgtgcgcacgccaattgtcacgacaagtg |
113 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40763671 |
gctgttgctcggattgggaatgctcttgcttatgctacacatacatttttcaacaagcatgggtttctttatgtgcgcacgccaattgtcacgacaagtg |
40763770 |
T |
 |
Q |
114 |
attgtgagggtgctggtgaaatgtttcaagtgacaactctgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaatc |
213 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40763771 |
attgtgagggtgctggtgaaatgtttcaagtgacaactctgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaatc |
40763870 |
T |
 |
Q |
214 |
t |
214 |
Q |
|
|
| |
|
|
T |
40763871 |
t |
40763871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 161 - 214
Target Start/End: Original strand, 40763938 - 40763991
Alignment:
Q |
161 |
gaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaatct |
214 |
Q |
|
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
40763938 |
gaagcagaaaggttggagaaggaacagatacagaatcctcctcctactgaatct |
40763991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 14 - 211
Target Start/End: Original strand, 42911399 - 42911596
Alignment:
Q |
14 |
gctgttgctcggattgggaatgctcttgcttatgctacacatacatttttcaacaagcatgggtttctttatgtgcgcacgccaattgtcacgacaagtg |
113 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
T |
42911399 |
gctgttgctcggattcggaatgctcttgcttatgctacacatacatttttcaacaagcatgggtttctttatgtgcacacgccaattgtcacgactagtg |
42911498 |
T |
 |
Q |
114 |
attgtgagggtgctggtgaaatgtttcaagtgacaactctgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctcctactgaa |
211 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
42911499 |
attgtgagggtgctggtgaaatgtttcaagtgacaactttgttcagtgaagcagagaggttggagaaggaactgatacagaatcctcctccaactgaa |
42911596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1816 times since January 2019
Visitors: 1430