View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0122_low_24 (Length: 222)
Name: NF0122_low_24
Description: NF0122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0122_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 138 - 204
Target Start/End: Complemental strand, 25565647 - 25565581
Alignment:
Q |
138 |
aatttaaatttggcaatagattccaaaatgataatattcatcgaataagcaaaattacaacttgata |
204 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
T |
25565647 |
aatttaaatttggcaataaattccaaaatgataatattcattgaataagcaaaattacaatttgata |
25565581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 97 - 135
Target Start/End: Complemental strand, 25565712 - 25565674
Alignment:
Q |
97 |
gagcagagacgatattaacatgcatgaagattccacata |
135 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||| |
|
|
T |
25565712 |
gagcagggacgatattaacatgcatgaagattccacata |
25565674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 29 - 80
Target Start/End: Complemental strand, 40763871 - 40763820
Alignment:
Q |
29 |
agattcagtaggaggaggattctgtatcagttccttctccaacctctctgct |
80 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40763871 |
agattcagtaggaggaggattctgtatcagttccttctccaacctctctgct |
40763820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 29 - 80
Target Start/End: Complemental strand, 40763991 - 40763940
Alignment:
Q |
29 |
agattcagtaggaggaggattctgtatcagttccttctccaacctctctgct |
80 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
T |
40763991 |
agattcagtaggaggaggattctgtatctgttccttctccaacctttctgct |
40763940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 32 - 80
Target Start/End: Complemental strand, 42911596 - 42911548
Alignment:
Q |
32 |
ttcagtaggaggaggattctgtatcagttccttctccaacctctctgct |
80 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42911596 |
ttcagttggaggaggattctgtatcagttccttctccaacctctctgct |
42911548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1564 times since January 2019
Visitors: 1425