View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0122_low_7 (Length: 366)
Name: NF0122_low_7
Description: NF0122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0122_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 98 - 285
Target Start/End: Complemental strand, 5922100 - 5921913
Alignment:
| Q |
98 |
atcagtttcttctcctccaatgggggagtttgttacgatccataaccattttttctaacaacttccgctgcaattttccctctctccttcatcttcttca |
197 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5922100 |
atcagtttcttctccttcaatgagggagtttgttacgatccataaccgttttttctaacaacttccgctgcaattttccctctctccttcatcttcttca |
5922001 |
T |
|
| Q |
198 |
ctgaatcttcatgattctgtgcttgattcttcatttttgtgcttgattgcttcgtcttcaagcttcgttctctgtgtatttgttgctt |
285 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5922000 |
ctgaatcttcatgattatgtgcttgattcttcatttttgtgcctgattgcttcgtcttcaagcttcgttctctatgtatttgttgctt |
5921913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 98 - 286
Target Start/End: Complemental strand, 20326357 - 20326168
Alignment:
| Q |
98 |
atcagtttcttctcctccaatgggggagtttgttacgatccataaccattttttctaacaacttccgctgcaattttccctctctccttcatcttcttca |
197 |
Q |
| |
|
|||||||||||||||| |||| || |||||||||| |||||||||| | ||||||||| ||||||||||||||||| ||| | ||| |||||||||||| |
|
|
| T |
20326357 |
atcagtttcttctccttcaattggagagtttgttaagatccataacaaccttttctaactacttccgctgcaatttttcctttttccatcatcttcttca |
20326258 |
T |
|
| Q |
198 |
ctgaatcttcatgattctgtgcttgattct-tcatttttgtgcttgattgcttcgtcttcaagcttcgttctctgtgtatttgttgcttc |
286 |
Q |
| |
|
|||||||||||||||||||| |||||||| | |||||||||||||||||||||||||||||||| ||| |||| | |||||||||||| |
|
|
| T |
20326257 |
ttgaatcttcatgattctgtgattgattctcttttttttgtgcttgattgcttcgtcttcaagctttgttttctgagaatttgttgcttc |
20326168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1611 times since January 2019
Visitors: 1426