View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0123_low_12 (Length: 264)
Name: NF0123_low_12
Description: NF0123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0123_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 89 - 214
Target Start/End: Complemental strand, 30417298 - 30417173
Alignment:
| Q |
89 |
aacctgtgctgcctttgctttgatcaattccttttcaaatattaatgttgttgttgttatccagggagacattccactgcagggagacttctctgctgaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30417298 |
aacctgtgctgcctttgctttgatcaattccttttcaaatattaatgttgttgttgttatccagggagacattccactgcagggagacttctctgctgaa |
30417199 |
T |
|
| Q |
189 |
catatgatattcggtggtgggttttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30417198 |
catatgatattcggtggtgggttttc |
30417173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1528 times since January 2019
Visitors: 1423